zebrafish fertilization

Consistent with the expression of Spaca6 exclusively in the male germline (Supplementary Figure S1A), spaca6/ females were fertile (Figure 2C), revealing that Spaca6 is only required for male fertility. Furthermore, Spaca6-deficient sperm have normal morphology, are motile, and can approach the egg, but fail to bind to the egg and therefore cannot complete fertilization. doi:10.1002/jez.1402430211, Yanagimachi, R., Cherr, G., Matsubara, T., Andoh, T., Harumi, T., Vines, C., et al. A founder fish carrying a germline mutation in the spaca6 gene was identified by a size difference in the spaca6 PCR amplicon in a pool of embryo progeny (primers: spaca6_gt_F: GCAGAGAAATCTTGATTGGAGG and spaca6_gt_R: AAGCAGACCAGTATACAATTTTTGC). Nucleic Acids Res. (C). Spaca6 KO sperm is morphologically normal and motile. doi:10.1073/pnas.1922650117. The zebrafish life cycle begins with a fertilized egg. Diagrams of Spaca6 proteins made in wild-type, spaca6/ and rescue [spaca6/; tg(actb2:spaca6-t2a-GFP)] zebrafish lines. (2020). After 2-3 months in the nursery, the fish reach adulthood, completing the lifecycle. (B). Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. doi:10.7554/eLife.66313, Jumper, J., Evans, R., Pritzel, A., Green, T., Figurnov, M., Ronneberger, O., et al. Manual Tracking. (2021). Nat. The boxed region is shown at higher magnification below. All JoVE videos and articles can be accessed for free. If you do not see the message in your inbox, please check your "Spam" folder. An 86-nt deletion in the spaca6/ line leads to a retained sequence from intron two and a premature stop-codon, resulting in a dysfunctional truncated protein (translated part of the intron is shown in black). This revealed thatsimilar to Izumo1Spaca6 homologs are present across vertebrates, while proteins containing a DC-STAMP-like domain, such as Dcst1 and Dcst2, show a much broader distribution across both vertebrates and invertebrates (Figure 1D). Total protein was visualized by Ponceau staining before blocking with 5% milk powder in 0.1% Tween in 1 TBS (TBST). Moreover, IZUMO1 was shown to be sufficient for cells to bind to the oocyte (Inoue et al., 2013; Noda et al., 2020), suggesting that one major role of IZUMO1 is to enable sperm to adhere to the egg surface. Unable to load video. This technique uses a labeled RNA molecule complementary to an mRNA of interest, to visualize gene expression throughout the entire organism. (2013). 2, 150296. doi:10.1098/rsos.150296, Hart, N. H., and Donovan, M. (1983). Science 287, 319321. The dcst2/ zebrafish line has been described previously (Noda et al., 2021). n.s, not significant (Mann-Whitney test, p > 0.05); error bars, SD; N = number of independent experiments; n = number of sperm. Sci. To study the role of Spaca6 in zebrafish fertilization, we first identified the full-length spaca6 mRNA and protein sequence in zebrafish. Our results show that testis-expressed Spaca6 is essential for zebrafish fertilization. (2009). (2016). (C). Please enter your Institution or Company email below to check. Fish and gametes are not drawn to scale. Although the number of somites defines the individual stages in this segmentation period, theres a lot more than that going on during its 10 hour duration. The pharyngula phase encompasses the next 24 hours until the embryos hatch into larvae. Further studies characterizing the molecular co-regulation of these factors will be necessary to understand their role in protein stability, binding and fusion. 26, R661R662. The protein domain predictions for zebrafish Spaca6 and mouse SPACA6 (Uniprot ID: E9Q8Q8) were obtained from InterPro (Blum et al., 2021). Please click here to activate your free 2-hour trial. Together, this study and studies in mice point towards a co-regulation of SPACA6 and DCST1/2. Whether these factors act purely as stabilization factors or whether they also play a role in sperm-egg interaction remains to be tested. Biol. 37, 391414. Spaca6 KO fish were generated by Cas9-mediated mutagenesis. Sci. (B). By this time, fertilized embryos have developed to 1000-cell stage embryos, while unfertilized eggs resemble one-cell stage embryos. Biol. doi:10.1093/nar/gky995, Fujihara, Y., Herberg, S., Blaha, A., Panser, K., Kobayashi, K., Larasati, T., et al. Moreover, we have shown that DCST1 and DCST2 are also necessary for zebrafish fertilization (Noda et al., 2021). Homozygous spaca6/ fish were generated by outcrossing spaca6+/- fish to wild-type fish and then incrossing spaca6+/- fish from the next generation. bioRxiv [Preprint]. Timestamps were calculated beginning with the addition of sperm to the eggs. To learn more about our GDPR policies click here. Bouncer/ females are sterile and sperm is unable to bind to Bouncer-deficient eggs, suggesting that Bouncer is involved in sperm-egg membrane binding (Herberg et al., 2018). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. Left: Experimental setup. 24, 279282. Scanning Electron Microscope Studies of Sperm Incorporation into the Zebrafish (Brachydanio) Egg. Its come a long way in just one day, but the embryos work is not yet done! Here we show that zebrafish spaca6 encodes for a sperm membrane protein which is essential for fertilization. Now that youre familiar with the major stages of zebrafish development, lets go over the first 24 hours in more detail. Genet. Sperm were counted as bound when they remained in the same position for at least 2min following a 90-s period in which they activated and approached the egg. doi:10.1242/dev.094854, Inoue, N., Hagihara, Y., and Wada, I. Alignment of Spaca6 protein sequences from different vertebrates shows that Spaca6 is conserved in its amino acid sequence and secondary structure elements (Figure 1B, Supplementary Figure S1B). Early development occurs at a rapid, but predictable rate when the embryos are raised at 28 C. (2019). To identify the sequence of the full-length spaca6 transcript that is expressed in testis, we isolated RNA from wild-type zebrafish testes and amplified a 954-nt region from cDNA that contained an extended Spaca6 N-terminus and a total of 9 exons. If you need immediate assistance, please email us at subscriptions@jove.com. Zebrafish Reproduction and Development. Out of the full set of 453 taxa containing either DC-STAMP, Izumo1 or Spaca6 proteins, 52 representative animal species were selected, and a taxonomic tree was retrieved using the NCBI Taxonomy CommonTree tool (Schoch et al., 2020). Natl. To this end, gRNAs were designed to target the third and fourth exons of the full-length spaca6 gene. Samples were then mixed with 4 Laemmli buffer containing -mercaptoethanol and boiled at 95C for 5min. 3l of stained spermatozoa (approximately 150,000300,000 sperm) was added as close to the egg as possible during image acquisition. Amplicon sequencing of adult fin-clips identified the 86-nt deletion, which results in a frameshift mutation and a premature stop codon in intron 2 (GRCz11: Chr16:24,907,548). The next morning, male and female fish were allowed to mate. Rev. Noda and others expressed the essential sperm factors involved in fusion, including IZUMO1, in HEK293T cells and observed that HEK293T cells were able to bind but were unable to fuse to ZP-free eggs, indicating the possible need for additional molecules that are involved in this process (Inoue et al., 2013; Noda et al., 2020). Received: 01 November 2021; Accepted: 07 December 2021;Published: 03 January 2022. doi:10.1038/73502, Lamas-Toranzo, I., Hamze, J. G., Bianchi, E., Fernndez-Fuertes, B., Prez-Cerezales, S., Laguna-Barraza, R., et al. (B). Identification of Spaca6 in zebrafish. After mounting using VECTASHIELD Antifade with DAPI (Vector Laboratories), sperm were imaged with an Axio Imager.Z2 microscope (Zeiss) with an oil immersion 63x/1.4 Plan-Apochromat DIC objective. Biol. Eggs were kept in place using a petri dish with cone-shaped agarose molds (1.5% agarose in sorting medium) filled with sorting medium. Protein folding predictions of mature Spaca6 (lacking the signal peptide sequence) were performed using AlphaFold2 (Jumper et al., 2021). Thanks for watching! This video will go over the zebrafish life cycle, early stages of embryo development, raising fish to adulthood, and highlight some techniques that take advantage of developing zebrafish embryos. 47, D427D432. Coverage tracks for RNA sequencing data from oocyte and testis aligned with ENSEMBL (ENSDART00000155083.2) and NCBI (XM_021466914.1) annotations as well as the full-length, newly identified testis coding DNA sequence (correct CDS). The discussion begins with a zygote consisting of a single cell, or blastomere, atop a large ball of yolk. Izumo1 knockout (KO) sperm can penetrate the zona pellucida (ZP), a glycoprotein coat surrounding the mammalian oocyte, but fail to fuse with the oolemma (Inoue et al., 2005). Zebrafish has recently emerged as a model organism to study vertebrate fertilization due to its genetic tractability, access to a large number of gametes and external fertilization. Putative founder fish were crossed to spaca6/ or spaca6+/ fish and the progeny was screened for fluorescence, raised to adulthood and genotyped using primers spaca6_gt_F and spaca6_gt_R to identify adult fish lacking endogenous spaca6. Left: Experimental setup. USA 117, 1149311502. doi:10.1146/ANNUREV-CELLBIO-120219-021751, Eddy, S. R. (1998). doi:10.1126/science.aat7113, Inoue, N., Ikawa, M., Isotani, A., and Okabe, M. (2005). Curr. In order to begin, please login. The JoVE video player is compatible with HTML5 and Adobe Flash. Taxonomic tree of DC-STAMP-like proteins, Izumo1 and Spaca6 across vertebrates and invertebrates. Interestingly, sperm lacking Spaca6 have decreased levels of another essential and conserved sperm fertility factor, Dcst2, revealing a previously unknown dependence of Dcst2 expression on Spaca6. If you have any questions, please do not hesitate to reach out to our customer success team. Sperm displacement was calculated by measuring the distance between the first and the last coordinates (normalized by 100 timeframes). Unactivated, mature eggs were squeezed from a wild-type female fish and activated by addition of E3 medium. By continuing to use our website or clicking Continue, you are agreeing to accept our cookies. Wild-type and spaca6/ sperm were labeled with MitoTracker (yellow) and subsequently incubated with activated and dechorionated wild-type eggs. 10, 200118. doi:10.1098/RSOB.200118, Waterhouse, A. M., Procter, J. Together, our results show that zebrafish Spaca6 regulates Dcst2 levels and is required for binding between the sperm membrane and the oolemma. (2009). Embryos to Study Gene Expression and Function, Histological Sample Preparation for Light Microscopy, Automated High-throughput Behavioral Analyses in Zebrafish Larvae, Laser-inflicted Injury of Zebrafish Embryonic Skeletal Muscle, Generating Chimeric Zebrafish Embryos by Transplantation. JoVE Science Education Database. Slides were briefly washed once in 1x PBS, and the sperm was permeabilized in 0.25% Tween in 1x PBS for 30min before blocking with 10% normal goat serum (Invitrogen) and 40g/ml BSA in PBST for at least 1h. Slides were then incubated with mouse anti-zebrafish-Dcst2 antibody in blocking buffer (1:650; (Noda et al., 2021)) overnight at 4C in a humidified chamber. (D). Larvae are usually fed a combination of rehydrated dry food and microorganisms, such as paramecia, to maximize growth rates. The Conserved Fertility Factor SPACA4/Bouncer Has Divergent Modes of Action in Vertebrate Fertilization. Furthermore, other sperm factorsfertilization influencing membrane protein (FIMP), sperm-oocyte fusion required 1 (SOF1), transmembrane protein 95 (TMEM95), sperm acrosome associated 6 (SPACA6) and the DC-STAMP-like domain-containing proteins DCST1 and DCST2have been shown to be required for sperm-egg fusion in mice (Barbaux et al., 2020; Lamas-Toranzo et al., 2020; Noda et al., 2020; Nado et al., 2021; Inoue et al., 2021). This zygote has a few important structures, including the protective membrane surrounding the embryo called the chorion and the yolk that provides nutrients for embryonic development until the fish can feed itself. Sperm were isolated from 2 to 4 wild-type and mutant male fish and kept in 150l Hanks saline containing 0.5M MitoTracker Deep Red FM (Molecular Probes) for >10min on ice. CD9, an integral membrane protein expressed on the oolemma, has also been shown to be required for gamete fusion (Kaji et al., 2000; le Naour et al., 2000; Miyado et al., 2000). *Correspondence: Victoria E. Deneke, victoria.deneke@imp.ac.at; Andrea Pauli, andrea.pauli@imp.ac.at, Present address: Anna Kogan, Department of Biochemistry, University of Oxford, Oxford, United Kingdom, These authors have contributed equally to this work, Fertilization in the Spotlight: Dynamics and Mechanisms of Sperm-Egg Interaction, View all We thank the team of the Biooptics facility at the Vienna Biocenter, in particular Pawel Pasierbek and Thomas Lendl, for support with microscopy and image analysis; the animal facility personnel from the IMP for taking excellent care of zebrafish; Anna Bandura for help with genotyping; Juraj Ahel for providing the AlphaFold2 script; Maria Novatchkova for help with RNA sequencing analysis; Andreas Blaha and Sara Berent for valuable help with the sperm morphology assay; and the entire Pauli lab for fruitful discussions. We recommend downloading the newest version of Flash here, but we support all versions 10 and above. Spaca6 has two gene annotations in the most recent zebrafish genome release (GRCz11): a predicted protein-coding gene containing 7 exons (NCBI: XM_021466914.1) and a predicted non-protein coding gene containing 8 exons (ENSEMBL: ENSDART00000155083.2). In the rescue line, a SGGSG spacer and a part of the viral T2A protein result in a C-terminal 23-aa addition. Since Dcst2 levels are disrupted in spaca6 KO sperm in zebrafish, Spaca6 may serve as a stabilization factor. Secondary and tertiary protein structure predictions were obtained using AlphaFold2 (Jumper et al., 2021). By just 24 hours post fertilization, the embryos are active and even have a beating heart! Enzymatic Assembly of DNA Molecules up to Several Hundred Kilobases. Although spaca6/ sperm drifted away after a few minutes (Figure 4A, Supplementary Movie S2), we conclude that spaca6/ sperm was able to approach and enter the micropyle similar to wild-type sperm. While rapidly depleting the energy stores of the yolk, the larvae soon develop specialized structures for swimming, like the swim bladder: A gas-filled organ that controls buoyancy. One of these conserved, testis-expressed factors is SPACA6, yet its function has not been investigated outside of mammals. Finally, the notion of a membrane complex needed for binding and fusion has been previously proposed (Barbaux et al., 2020; Noda et al., 2020). Therefore, we conclude that Spaca6 is required for sperm to stably adhere to the egg plasma membrane in zebrafish. Their rapid, external development and transparency make them uniquely suited to visualization. To investigate whether this regulation holds true reciprocally, we measured Dcst2 protein levels and localization in spaca6/ sperm, using an antibody recognizing zebrafish Dcst2 (Noda et al., 2021). Rutgers, The State University of New Jersey - Busch Campus, United States, Institut National de la Sant et de la Recherche Mdicale (INSERM), France. Sperm Meets Egg: The Genetics of Mammalian Fertilization. In addition, an extended region of IZUMO1 (corresponding to human 1219) was used and searched for with NCBI blastp in the NCBI nr database (E-value < 0.001). The resulting time-lapse movies were analyzed using Fiji. Zool. Secondary structure prediction of the zebrafish Spaca6 protein sequence is depicted above the sequence alignment (coil: alpha-helix; arrow: beta-sheet). (2020). Now that weve seen some of the major stages of zebrafish development, lets look at some techniques used to study these steps. doi:10.1093/bioinformatics/btp033, Wolenski, J. S., and Hart, N. H. (1987). Tubulin protein levels of the same blot are shown as loading control. The uncropped immunoblot is shown in Supplementary Figure S2. Sci. Quantification of sperm binding. To date, only a few proteins have been shown to be essential for sperm-egg binding and fusion in mice, and only some are conserved across vertebrates. This video provides a brief overview of the major phases of zebrafish development, with particular focus on the first 24 hours post fertilization (hpf). doi:10.1093/nar/gkab301, Miyado, K., Yamada, G., Yamada, S., Hasuwa, H., Nakamura, Y., Ryu, F., et al. We use/store this info to ensure you have proper access and that your account is secure. Time-lapse images of sperm approaching the micropyle of wild-type eggs. The extracellular domain (ECD) is shown in blue, while the Immunoglobulin-like domain (IG) is shown in orange. This method allows researchers to examine how cell interactions contribute to organ function as well as to easily visualize cell movements in vivo. In contrast, our findings in zebrafish reveal that zebrafish sperm lacking Spaca6 is already unable to bind to the egg membrane, and is thus required in a step before fusion can take place. The Ly6/uPAR Protein Bouncer Is Necessary and Sufficient for Species-specific Fertilization. Sperm that were present in the movie for more than 30 timeframes were tracked for as many frames as possible. TMEM95 Is a Sperm Membrane Protein Essential for Mammalian Fertilization. Right: Representative images of wild-type (top) and spaca6/ (bottom) sperm binding to the surface of the egg 2min after sperm addition. It is worth pointing out that a fraction of the total number of bound wild-type sperm may have not only bound but also fused to the oolemma. Wild-type sperm were frequently found bound to the oolemma. R. Soc. Sperm was spun onto an adhesive slide with a CytoSpin 4 (Thermo Fisher Scientific) at 800rpm for 3min. 50, 93111. The protein sequence alignment of vertebrate Spaca6 amino acid sequences was performed using the Muscle alignment tool (http://www.drive5.com/muscle/, version 3.8.31) and visualized with Jalview (Waterhouse et al., 2009). If the problem continues, please. Severely Reduced Female Fertility in CD9-Deficient Mice. Therefore, zebrafish represents an interesting model system for the study of fertilization; despite the presence of mammalian fertilization factors in fish (Dcst1/2, Bouncer/SPACA4), the currently characterized factors show functional divergence in the fertilization process (Fujihara et al., 2021; Noda et al., 2021). Direct evidence that essential sperm factors co-regulate each other was recently reported in mice (Inoue et al., 2021). However, both wild-type and mutant sperm showed comparable motility and directed displacement (Figures 3C,D, Supplementary Movie S1). We make two major findings: 1) In zebrafish, the absence of Spaca6 leads to a disruption in the sperms binding ability to the egg surface and 2) the levels of another key fertilization factor, Dcst2, depend on the presence of Spaca6. For visualizing Tubulin levels, membranes were stripped using Restore Western Blot Stripping Buffer (Thermo Fisher Scientific) before washing, blocking and incubation with mouse anti-alpha-Tubulin antibody [1:20.000 (T6074, Merck)] and proceeding with secondary antibody staining and detection as described above. Ready to adopt a fish? Sperm from zebrafish males was collected in 3.7% formaldehyde diluted in Hanks saline solution and stored on ice for 20min to 1h. Sperm was pelleted by centrifugation at 850rpm for 3min, and the fixative was replaced with Hanks saline. For the purpose of Open Access, the author has applied a CC BY public copyright license to any Author Accepted Manuscript (AAM) version arising from this submission. Cel Dev. Next, the dramatic cellular movements known as epiboly and gastrulation are explained, revealing how they contribute to reshaping a mass of cells into a moving embryo with a beating heart in just 1 day. Immunoblot of sperm samples of different genotypes probed with antibodies against zebrafish Dcst2. Please enjoy a free 2-hour trial. Zebrafish spaca6 knockout males are sterile. In recent years, several proteins have been shown to be essential for sperm-egg interaction in mammals. Sperm Proteins SOF1, TMEM95, and SPACA6 Are Required for Spermoocyte Fusion in Mice. After focusing on the egg plasma membrane, the objective was briefly lifted to add 25l of stained sperm (approximately 200,000250,000 sperm). Representative differential interference contrast (DIC) images of wild-type and spaca6/ sperm. After SDS-PAGE, samples were wet-transferred onto a nitrocellulose membrane. (B). FIGURE 4. The evening prior to mating, male and female fish were separated in breeding cages (one male and one female per cage). Zebrafish (Danio rerio) were raised according to standard protocols (28C water temperature, 14/10h light/dark cycle). As observed in the sperm approach assay, spaca6/ sperm was able to reach the egg, but failed to stably bind to the egg surface (Figure 4B, Supplementary Movie S3). Copyright 2022 MyJoVE Corporation. Our data therefore suggests that Spaca6 regulates Dcst2 protein levels. Spaca6 may contribute to forming and/or stabilizing such a multi-factor complex on the sperm membrane that regulates both binding and fusion. Coordinates of the sperm cells were used to calculate average sperm speed and displacement. Nucleic Acids Res. Genet. The Pfam Protein Families Database in 2019. Even though Spaca6 is conserved among vertebrates (Figures 1BD), the step at which fertilization stalls in the absence of Spaca6 differs between zebrafish and mice. Interactive Tree of Life (iTOL) V5: an Online Tool for Phylogenetic Tree Display and Annotation. To obtain the correct, full-length sequence for zebrafish Spaca6, wild-type zebrafish testis cDNA was used for amplifying a region predicted to encompass the full-length protein sequence (primers used for PCR: Spaca6_CDS_F: GCTACTTGTTCTTTTTGCAGGATCCGCCACCATGTTTGTGTTTATTGCAAAAC and Spaca6_CDS_R: ACACTCCTGATCCTCCTGAGAATTCGGCTGGATTAGAAACGTTG). Transgenic Spaca6 partially rescued the fertilization defect of spaca6 KO males (Figure 2C), suggesting that the fertility defect is indeed due to a lack of Spaca6. 227, 277296. This final inner canal is 2.3m in diameter and is therefore only able to accommodate a single sperm head (Hart and Donovan, 1983; Wolenski & Hart, 1987). Sperm speed and displacement (per 100s). On a molecular level the observed difference could possibly be reconciled from mouse experiments involving IZUMO1. The amplified region was cloned and subsequently sequence-verified (submitted to NCBI as GeneID:101885333; NM_001397778.1). (2020). Please check your Internet connection and reload this page. All fish experiments were conducted according to Austrian and European guidelines for animal research and approved by the Amt der Wiener Landesregierung, Magistratsabteilung 58Wasserrecht. Multiple events, such as sperm migration through the female reproductive tract, sperm activation, gamete fusion and egg activation are necessary for fertility and contribute to the formation of a new organism (Bianchi and Wright, 2016; Stein et al., 2020; Deneke and Pauli, 2021). Nucleic Acids Res. During the blastula period, the embryo begins to make its own RNA, thus lengthening the cell cycle. Zebrafish Reproduction and Development. 25, 33893402. SP, signal peptide; TMD, Transmembrane domain; CD, Cytoplasmic domain. Biology II: Mouse, Zebrafish, and Chick. These rapid divisions are possible because RNA deposited in the egg by the mother is used to make the proteins functioning within the blastomeres, eliminating the need for RNA synthesis. Schoch, C. L., Ciufo, S., Domrachev, M., Hotton, C. L., Kannan, S., Khovanskaya, R., et al. The Structure of Sperm Izumo1 Reveals Unexpected Similarities with Plasmodium Invasion Proteins. To get started, a verification email has been sent to email@institution.com. Future experiments exploring the role of Izumo1 in zebrafish fertilization as well as potential co-regulation of Spaca6 and Izumo1 will help elucidate the molecular mechanisms in fish and mammalian systems alike. We use cookies to enhance your experience on our website. To confirm that the observed fertilization defect of spaca6/ males was caused by the absence of Spaca6 protein, we generated a rescue line that ubiquitously expresses Spaca6 in a spaca6/ background [spaca6/; tg(actb2:spaca6-T2A-GFP)], hereafter referred to as spaca6/; tg(spaca6). Scheme of a mating assay performed to quantify fertilization rates. Further investigation of the co-regulation and potential interaction between Spaca6, Dcst1/2, Izumo1 and other known essential fertilization factors may help elucidate the mechanism of gamete fusion on a molecular level. Front. Open Sci. doi:10.7554/eLife.53913, le Naour, F., Rubinstein, E., Jasmin, C., Prenant, M., and Boucheix, C. (2000). (A). (C). 49, D480D489. Sperm were isolated from 2 to 4 wild-type and mutant male fish and kept in 200l Hanks saline containing 0.5M MitoTracker Deep Red FM (Molecular Probes) on ice. Acad. During the cleavage period, the blastodisc divides to form the blastomeres, which continue to undergo rapid, synchronized cell divisions with no cell growth. Creative Commons Attribution License (CC BY). JoVE, Cambridge, MA, (2022). More. When the cells have advanced to cover about half of the yolk the gastrula period begins. Eggs were collected and kept at 28C in E3 medium (5mM NaCl, 0.17 mM KCl, 0.33mM CaCl, 0.33mM MgSO, 0.00001% Methylene blue). Tertiary structure predictions of mouse and zebrafish Spaca6. doi:10.1126/science.287.5451.321, Nishimura, K., Han, L., Bianchi, E., Wright, G. J., de Sanctis, D., and Jovine, L. (2016). After 7 dpf, the young fish, or fry, are fully mobile and looking for food! doi:10.1093/bioinformatics/14.9.755, El-Gebali, S., Mistry, J., Bateman, A., Eddy, S. R., Luciani, A., Potter, S. C., et al. Zebrafish lines expressing transgenic Spaca6 were generated by injecting the spaca6 expression construct with Tol2 mRNA into spaca6+/ zebrafish embryos (15ng/l of the plasmid in RNase-free water, 35ng/l Tol2 mRNA, 0.083% phenol red solution [Sigma-Aldrich]), following standard procedures. If you want more info regarding data storage, please contact gdpr@jove.com. Please enter an institutional email address. Values were compared to tubulin levels and normalized to wild type. Despite these recent advances, the molecular mechanisms of gamete fusion and the interplay between the various sperm and egg factors remain unclear. doi:10.1371/journal.pone.0098186, Gibson, D. G., Young, L., Chuang, R.-Y., Venter, J. C., Hutchison, C. A., and Smith, H. O. (D). Bioinformatics 25, 11891191. Cells in each of these three layers have very different fates: The ectoderm gives rise to epidermis and nervous system, the endoderm forms the gut, and the mesoderm generates muscle, bone, and vasculature. Sperm tracks were analyzed using Fiji with the manual tracking plugin (Cordelieres, 2005). Imaging was performed with a LSM800 Examiner Z1 upright system (Zeiss) using a 20x/0.3 Achroplan water dipping objective. Scale bar = 10m. (2011). This is in contrast to murine sperm lacking SPACA6, which was reported to be able to bind but unable to fuse with oocytes. Cas9 protein and spaca6 sgRNAs were co-injected into the cell of one-cell stage TLAB embryos. Deneke, V. E., and Pauli, A. Injected embryos with high expression of sfGFP at 1day post fertilization were raised to adulthood. Dcst2 levels were significantly decreased in spaca6/ sperm, as revealed by immunoblotting (Figures 5A,B, Supplementary Figure S2) and immunofluorescence imaging, which showed a reduction of Dcst2-positive foci around the sperm plasma membrane (Figure 5C). This was in contrast to wild-type sperm, which was able to stably bind to the egg surface for at least 1minute (Figure 4C, Supplementary Movie S3). Finally, the video concludes with some common techniques utilized for studying embryo development, demonstrating how zebrafish are used to help us better understand human development and disease. The Gamete Fusion Process Is Defective in Eggs of Cd9-Deficient Mice. Fast, Scalable Generation of High-Quality Protein Multiple Sequence Alignments Using Clustal Omega, Mol. Natl. Proc. Highly Accurate Protein Structure Prediction with AlphaFold. 88, 47. doi:10.1095/biolreprod.112.105072, Keywords: fertilization, zebrafish, sperm-egg interaction, gamete, sperm, reproduction, Citation: Binner MI, Kogan A, Panser K, Schleiffer A, Deneke VE and Pauli A (2022) The Sperm Protein Spaca6 is Essential for Fertilization in Zebrafish. doi:10.1038/nature03362, Inoue, N., Hamada, D., Kamikubo, H., Hirata, K., Kataoka, M., Yamamoto, M., et al. Youll need a nursery to raise your fry to adulthood. Annu. To test whether Spaca6 is required for fertilization in zebrafish, we assessed the fertilization rates of wild-type, heterozygous and homozygous KO fish (Figures 2B,C). Reprod. Youve just watched JoVEs video on zebrafish development. If you would like to continue using JoVE, please let your librarian know as they consider the most appropriate subscription options for your institutions academic community. Differential interference contrast (DIC) images did not show any gross morphological differences between spaca6/ and wild-type sperm (Figure 3A). Additionally, embryos are amenable to both physical and genetic manipulations, allowing researchers to tease apart the signals controlling developmental processes. After 10min, 12 eggs were manually dechorionated using forceps and one egg was transferred to a cone-shaped 2% agarose-coated imaging dish with E3 medium. Older browsers that do not support HTML5 and the H.264 video codec will still use a Flash-based video player. The Immunoglobulin Superfamily Protein Izumo Is Required for Sperm to Fuse with Eggs.